circad | circRNAs associated with diseases

mmu-circRNA-7063
Gene	n/a	Organism	Mouse
Genome Locus	chr13:116893000-116902856:-	Build	n/a
Disease	Osteoarthritis (OA)	ICD-10	Polyarthrosis, unspecified (M15.9)
DBLink	Link to database	PMID	29247798
Experimental Method
Sample Type	Mouse Articular Chondrocytes (MACs)	Comparison	Mouse Articular Chondrocytes (MACs) were cultured in DMEM medium with and without IL-1β stimulation
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATATTGTGTGGTGTGTGATGA ACC Reverse TCCCAATCCAAACCGCTCT	Statistics	Fold Change : Upregulated,3.621618 pvalue : p=0.040911
Citation
Zhou, Z, Du, D, Chen, A, Zhu, L (2018). Circular RNA expression profile of articular chondrocytes in an IL-1β-induced mouse model of osteoarthritis. Gene, 644:20-26.